haplogroup g originhaplogroup g origin
Geographic spread patterns of the P303-derived groups defined by L497, U1 and P15(xP303)-derived P16 and M406 lineages, all of which achieve a peak frequency of at least 10%, are presented in Figures 2bf, respectively. Farther north, 8% of ethnic Hungarian males and 5.1% of ethnic Bohemian (Czech) males have been found to belong to Haplogroup G. In South Asia, some ethnic minorities possess haplogroup G at concentrations of approximately 18%[21] to 20%[22] of Kalash, approximately 16% of Brahui,[22] and approximately 11.5% of sampled Pashtun,[21] but in only about 3% of the general Pakistani population. MH and MHS are thankful to the National Institute for Genetic Engineering and Biotechnology, Tehran, Iran, and the National Research Institute for Science policy, Tehran, Iran, for providing the samples. Looking still more closely at the distribution of P303 sub-clades, some distinct patterns emerge in the network (Figure 4). Int J Legal Med 1997; 110: 141149. Provided by the Springer Nature SharedIt content-sharing initiative, European Journal of Human Genetics (2021), European Journal of Human Genetics (2020), European Journal of Human Genetics (Eur J Hum Genet) AAL thanks the Sorenson Molecular Genealogy Foundation. Thus, these estimates should be viewed as the upper bounds of dispersal times. Rosser ZH, Zerjal T, Hurles ME et al. Haplogroup G (Y-DNA) In human genetics, Haplogroup G (M201) is a Y-chromosome haplogroup. White PS, Tatum OL, Deaven LL, Longmire JL : New, male-specific microsatellite markers from the human Y chromosome. The identities of the specific 19 loci that define the STR haplotypes are reported in Supplementary Table S3 and Figure 4 legend. Haplogroup G, together with J2 clades, has been associated with the spread of agriculture, especially in the European context. Paleolithic Y-haplogroup heritage predominates in a Cretan highland plateau. G-M201 has also been found in Neolithic Anatolian sites such as Boncuklu dating back to 8300-7600 BCE, and Barcin dating back to 6419-6238 BCE. However, no clinal patterns were detected in the spatial autocorrelation analysis of the five sub-haplogroup frequencies with distance, suggesting that the distributions are not clinal but rather indicative of isolation by distance and demographic complexities. In Lebanon, however, G accounts for 6.5% of the population and in Iran to around 10%. Taken as a collective group, P303-derived chromosomes are the most widespread of all hg G lineages (Supplementary Table S1 and Figure 2b) and clearly display differential geographic partitioning between L497 (Figure 2c) and U1 (xM527) (Figure 2d). G is found mostly in the north central Middle East and the Caucasus, with smaller numbers around the Mediterranean and eastward. King RJ, Ozcan SS, Carter T et al. Age: About 7,800 years ago Origin: Eurasia Y-Haplotree. OS thanks the Italian Ministry of the University: Progetti Ricerca Interesse Nazionale 2009 and FIRB-Futuro in Ricerca 2008 and Fondazione Alma Mater Ticinensins. Y-chromosomal evidence of the cultural diffusion of agriculture in Southeast Europe. Men who belong to this group but are negative for all G2 subclades represent a small number of haplogroup G men. The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans: a Y chromosome perspective. Nat Commun 2012; 3. de Knijff P, Kayser M, Caglia A et al. Excavating Y-chromosome haplotype strata in Anatolia. L223 is found on the Y chromosome at rs810801 and 6405148 with a mutation from C to G. L223 was first identified in samples at 23andMe in 2009 but proved problematic as an individual test, the first successful results being reported at Family Tree DNA in late 2011 under its assigned L223 label. [12] The fourth site also from the same period is the tztal of the Italian Alps where the mummified remains of tzi the Iceman were discovered. The following SNPs are so far identified as M201 equivalents: L116, L154, L269, L294, L240, P257, L402, L520, L521, L522, L523, L605, Page 94, U2, U3, U6, U7, U12, U17, U20, U21, U23 and U33. ), Haplogroup M, as of 2017, is also known as K2b1b. In addition, there are multiple other SNPs thought to have the same coverage as M201. An assessment of the Y-chromosome phylogeography-based proposal that the spread of G2a-L497 chromosomes originated from Central Europe could be achieved by typing this SNP in the Holocene period human remains from Germany31 as well as those from France and Spain.45, 46 Certainly, Y chromosome represents only a small part of human genome and any population-level interpretation of gene flow in this region would have to be supported by genome-wide evidence. The presence of the SNP P18 mutation characterizes G2a1a's only subclade, G2a1a. Lacan M, Keyser C, Ricaut FX et al. The coming of the Greeks to Provence and Corsica: Y-chromosome models of archaic Greek colonization of the western Mediterranean. There are distinctive Ashkenazi Jewish and Kazakh subclades based on STR marker value combinations. Name: G-L14 Age: 7800 ybp 1700 CI 95% Expansion: 5200 ybp 1900 CI 95% Parent: G-L1 Note: This information does not imply an endorcement of YFull or their methods. The first principal component separates the populations of the Caucasus from those of Europe, with the Near/Middle Eastern populations being intermediate (Figure 3a). The geographic origins of a Y chromosome haplogroup for males can be deciphered from the phylogenetic tree of mankind, or the Y-DNA Haplogroup Tree, maintained by the International Society of Genetic Genealogy ( ISOGG, 2016 ). We genotyped binary markers following PCR amplification, by either Denaturing High Performance Liquid Chromatography, RFLP analysis, Taqman assay (Applied Biosystems, Foster City, CA, USA) or direct Sanger sequencing methodology. Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood. You belong to a subgroup of haplogroup G (G-M201), The Caucasus Mountaineers, and your oldest. This haplogroup was found in a Neolithic skeleton from around 5000 BC, in the cemetery of Derenburg Meerenstieg II, Germany, which forms part of the Linear Pottery culture, known in German as Linearbandkeramik (LBK),[11] but was not tested for G2a3 subclades. L1771.1/ L177_1, L1771.2/L177_2, L177.3/L177_3) was withdrawn as an identifier by ISOGG in 2013, after it was "found to be an unreliable palindromic snp". In Egypt, studies have provided information that pegs the G percentage there to be between 2% and 9%. Am J Hum Genet 2004; 74: 5061. PLoS One 2011; 6: e17548. Samples from persons with British Isles, Sicilian and Turkish ancestry have been identified. In the Near/Middle East, the highest P303 frequency is detected among Palestinians (17.8%), whereas in Europe the frequency does not exceed 6%. contracts here. Nonetheless, coalescent times provide a valuable/informative relative metric for estimating the time of lineage formation. Should any man with the P15 mutation test negative (ancestral) for any of these or vice versa, that finding would be the basis of a new G2a category. Included within G-L91 are some men with double values for STR marker DYS19, but there are also G2a2 men with this finding who are not L91+. Basically, haplogroups refer to organisms that have a common ancestor, identified by studying the nucleotide and mitochondrial mutations in cells. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. The highest percentage of G-P303 persons in a discrete population so far described is on the island of Ibiza off the eastern Spanish coast. Haplogroup G ( M201) is a human Y-chromosome haplogroup. RV thanks the European Union Regional Development Fund for support through the Centre of Excellence in Genomics, the Estonian Ministry of Education and Research for the Basic Research grant SF 0270177As08. Semino et al. [36], G-PF3359 (or G2a2b2b; previously G2a3b2) was known prior to 2013 as G-L177. JD and JC were supported by ANR program AFGHAPOP No BLAN07-9_222301. The hg G2a3b1c-L497 sub-cluster, on the other hand, has so far been found essentially in European populations and therefore is probably autochthonous to Europe. The final major subclade is characterized by presence of the SNP Z1903 and by a value of 9 at marker DYS568. The haplogroups contain many branches called subhaplogroups or subclades. The members of G-PF3359 are probably smaller in number than men included in G-P303, but only a small amount of testing has occurred for the relevant mutations. Eur J Hum Genet 2009; 17: 820830. These Neolithic European were descendants of Neolithic farmers from Anatolia, among some of the earliest peoples in the world to practice agriculture. The L91 mutation is found at 21327383 and rs35474563 on the Y-chromosome. RV and DMB thank the European Commission, Directorate-General for Research for FP7 Ecogene grant 205419. The Network 4.6.0.0 (Fluxus-Engineering) program was used (median-joining algorithm and the post-processing option). The results were analyzed using the ABI PRISM program GeneMapper 4.0 (Applied Biosystems). [26][27] Among the Druze mostly residents of Israel 10% were found to be haplogroup G.[28], Around 10% of Jewish males are Haplogroup G.[citation needed], In Africa, haplogroup G is rarely found in sub-Saharan Africa or south of the horn of Africa among native populations. and JavaScript. [citation needed] It is provided at the request of readers. Iceman tzi, known to have been a haplogr. (a)(f) Spatial frequency maps of haplogroup G (hg G) and its sub-clades with frequencies over 10%. Haplogroup G is a branch on the maternal tree of human kind. https://doi.org/10.1038/ejhg.2012.86, DOI: https://doi.org/10.1038/ejhg.2012.86. A clade of closely related Ashkenazi Jews represent virtually all G2b persons, with just three other G2b haplotypes having been reported so far: one Turk from Kars in northeast Turkey near Armenia, one Pashtun, and one Burusho in Pakistan. The National Geographic Society places haplogroup G origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic Two scholarly papers have also suggested an origin in the Middle East, while differing on the date. Another frequent sub-clade of the G2a3-M485 lineage is G2a3a-M406 (Figure 2e). Two additional markers, DYS38829, 30 and DYS46131 were typed separately. PLoS One 2009; 4: e5792. A network analysis of representative hg G-P16 Y-STR haplotypes reveals a diffuse cluster (Supplementary Figure S2). Am J Hum Genet 2007; 80: 759768. We emphasize that our assessments are based solely on contemporary DNA distributions rather than actual prehistoric patterns. Balanovsky O, Rootsi S, Pshenichnov A et al. These two reported Pakistani G-M377 haplotypes are quite divergent from the Ashkenazi Jewish clade, and therefore do not at all indicate a recent common origin. There are seeming pockets of unusual concentrations within Europe. ), International Society of Genetic Genealogy, List of genetic results derived from historical figures, Y-chromosome haplogroups in populations of the world, Y-DNA haplogroups in populations of Europe, Y-DNA haplogroups in populations of the Caucasus, Y-DNA haplogroups in populations of the Near East, Y-DNA haplogroups in populations of North Africa, "Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus", Atlas of the Human Journey: Haplogroup G (M201), "The Geographic Origins of Ethnic Groups in the Indian Subcontinent: Exploring Ancient Footprints with Y-DNA Haplogroups", "Late Pleistocene human genome suggests a local origin for the first farmers of central Anatolia", "Early farmers from across Europe directly descended from Neolithic Aegeans", "Ancient DNA suggests the leading role played by men in the Neolithic dissemination", "Ancient DNA from European Early Neolithic Farmers Reveals Their Near Eastern Affinities", "From surnames to the history of Y chromosomes: the Sardinian population as a paradigm", "Paleolithic Y-haplogroup heritage predominates in a Cretan highland plateau", "Y-chromosomal evidence of the cultural diffusion of agriculture in southeast Europe", "Y Chromosomal Evidence for a Limited Greek Contribution to the Pathan Population of Pakistan", "Polarity and temporality of high-resolution y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of Central Asian pastoralists", "A prehistory of Indian Y chromosomes: Evaluating demic diffusion scenarios", "Dual Origins of the Japanese: Common Ground for Hunter-Gatherer and Farmer Y-Chromosomes", "Dissecting the influence of Neolithic demic diffusion on Indian Y-chromosome pool through J2-M172 haplogroup", "Isolates in a corridor of migrations: a high-resolution analysis of Y-chromosome variation in Jordan", "Chromosome Diversity Characterizes the Gulf of Oman", "The Druze: A Population Genetic Refugium of the Near East", "The Levant versus the Horn of Africa: Evidence for Bidirectional Corridors of Human Migrations", "Geographical Structure of the Y-Chromosomal Genetic Landscape of the Levant: A Coastal-Inland Contrast", "The place of the Basques in the European Y-chromosome diversity landscape", "A Back Migration from Asia to Sub-Saharan Africa Is Supported by High-Resolution Analysis of Human Y-Chromosome Haplotypes", "Kinship and Y-Chromosome Analysis of 7th Century Human Remains: Novel DNA Extraction and Typing Procedure for Ancient Material", "The genetic legacy of religious diversity and intolerance: paternal lineages of Christians, Jews, and Muslims in the Iberian Peninsula", http://ytree.ftdna.com/index.php?name=Draft&parent=20173662, "..Project Rosters - Haplogroup G Project", "Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood", "Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events", "The phylogeography of Y chromosome binary haplotypes and the origins of modern human populations", "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree", http://ymap.ftdna.com/cgi-bin/gbrowse_details/hs_chrY?name=L240;class=Sequence;ref=ChrY;start=3191153;end=3191153;feature_id=40369, "Improved Resolution Haplogroup G Phylogeny in the Y Chromosome, Revealed by a Set of Newly Characterized SNPs", "Identification of the remains of King Richard III", https://haplogroup.info/all-ancient-dna-full.xlsx, "Results from the Hamman Family Y-Chromosome DNA Tests", "Haplogroup G2a (Y-chromosomal DNA) - Eupedia", Y-DNA Haplogroup G and its subclades from the current year ISOGG haplotree. However, its sub-clades have more localized distribution with the U1-defined branch largely restricted to Near/Middle Eastern and the Caucasus, whereas L497 lineages essentially occur in Europe where they likely originated. The discovery of new SNPs can result in assignment of new names to haplogroup categories. Cavalli-Sforza L, Menozzi P, Piazza A : The History and Geography of Human Genes. [43] L240 was identified in 2009. In addition, we introduce five new markers: M426, M461, M485, M527 and M547 (Supplementary Table S2). Specifically, we intersected these criteria by applying the following filters. Chiaroni J, King RJ, Myres NM et al. Am J Hum Genet 2008; 82: 873882. King RJ, DiCristofaro J, Kouvatsi A et al. It encompasses a small group of Hispanic men who also so far all have the odd value of 13,21 at the YCA marker. SR thanks the Estonian Science Foundation for grant 7445 and M Metspalu for grant 8973. The L293 SNP that characterizes a third subclade was identified in June 2010 at Family Tree DNA. Men with the haplogroup G marker moved into Europe in Neolithic times. To accommodate for variability in sample sizes and hg G content, haplogroup diversity was calculated using the method of Nei37 only in the 52 instances when total population sample size exceeded 50 individuals and 5hg G chromosomes were observed. Haplogroup H dominates present-day Western European mitochondrial DNA variability (>40%), yet was less common (~19%) among Early Neolithic farmers (~5450 BC) and virtually absent in Mesolithic . Because M201 was identified first, it is the standard SNP test used when testing for G persons. It is not found among Native Americans except where intermarriage with non-native persons has occurred. In 2009-10, Family Tree DNA's Walk through the Y Project, sequencing certain Y-chromosome segments, provided a number of new G SNPs with the L designation. (Behar et al., 2012b) Origin Most researchers consider the birthplace of G to have been born in East Asia. In the Tirol (Tyrol) of western Austria, the percentage of G-M201 can reach 40% or more; perhaps the most famous example is the ancient remains of the so-called "Iceman", tzi. There were only a few G categories until 2008 when major revisions to categories were made. Google Scholar. A subset of 693 samples was typed for short tandem repeats of Y-chromosome (Y-STRs) using the 17 STR markers in the Applied Biosystems AmpFlSTR Yfiler Kit according to manufacturer recommendations. Sengupta S, Zhivotovsky LA, King R et al. G2a2b2a is also found in India. Although the low frequency of hg G1-M285 makes it impractical to justify displaying a spatial frequency map, it is found (Supplementary Table S1) in the Near/Middle East including Anatolia, the Arabian Peninsula and Persian Gulf region, as well as Iran and the South Caucasus (mostly Armenians). Kayser M, Caglia A, Corach D et al. Haplogroup H The coalescence age estimate of 9400 years for P16 coincides with the early Holocene (Supplementary Table S4). In human genetics, Haplogroup G (M201) is a Y-chromosome haplogroup. 25 and 0.00069 denote the assumed average generation time in years and the effective mutation rate, respectively, and 1000 is used to convert the result of the equation (into thousands of years). This group has been linked with the Crypto-Jewish population which fled to the island during the time of the Spanish Inquisition, of which a significant portion are identifiable as G-Z725 (DYS388=13). The general frequency pattern of hg G overall (Figure 2a) shows that the spread of hg G extends over an area from southern Europe to the Near/Middle East and the Caucasus, but then decreases rapidly toward southern and Central Asia. The most commonly occurring subclades are G1* (M285) and many subclades of G2 (G-P287), especially: G2a (P15), G2a1 (G-FGC7535, formerly G-L293), G2a2b2a (G-P303) formerly G2a3b1); G2a2b1 (G-M406) formerly G2a3a; G2a2b2a1 (G-L140) formerly G2a3b1a; G2a2b2a1a1b (G-L497) formerly G2a3b1a2; G2a2b2a1a1a1 (G-L13) formerly G2a3b1a1a; G2a2b2a1a1c1a (G-CTS5990 or G-Z1903) formerly G2a3b1a3; G2b (G-M3115) and; G2b1 (G-M377), formerly G2b. Using Y-STR data, the Td expansion time for all combined P15-affiliated chromosomes was estimated to be 150822217 years ago. PubMed G1-M285, previously described in the Iranian population . Balanovsky O, Dibirova K, Dybo A et al. Drawing the history of the Hutterite population on a genetic landscape: inference from Y-chromosome and mtDNA genotypes. The mutation involves a change from C to T.[citation needed] L223 is found on the Y chromosome at rs13304806. (2004) Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the . Battaglia V, Fornarino S, Al-Zahery N et al. Such temporal estimates must be viewed with caution owing to differences in individual STR locus mutation rates, sensitivity to rare outlier STR alleles and complexities related to multiple potential founders during a demographic event. To obtain Proc Natl Acad Sci USA 2011; 108: 1825518259. G-P16 is also occasionally present in Northeast Caucasus at lower frequencies (Supplementary Table S1), consistent with a previous report.3 Outside the Caucasus, hg G-P16 occurs at 1% frequency only in Anatolia, Armenia, Russia and Spain, while being essentially absent elsewhere. Its age is between 7,700 and . PAU thanks Professor Carlos D Bustamante. [7], (Subclades here conform to the Y-DNA SNP definitions used by ISOGG In 2012, several categories found only in one man in research studies were removed from the ISOGG tree causing some renaming. The emergence of Y-chromosome haplogroup J1e among Arabic-speaking populations. Circles represent microsatellite haplotypes, the areas of the circles and sectors are proportional to haplotype frequency (smallest circle corresponds to one individual) and the geographic area is indicated by color. A high percentage of G-Z1903 men belong to its subclade, G-Z724. Croat Med J 2005; 46: 502513. Members of this group have been found in Europe and the Middle East.[3]. Correspondence to Almost all L141 men belong to L141 subclades. However, interpretations based on simple haplogroup frequency clines do not recognize underlying patterns of genetic diversification. Although progress has been recently made in resolving the haplogroup G phylogeny, a comprehensive survey of the geographic distribution patterns of the significant sub-clades of this haplogroup has not been conducted yet.
